Biologia Selectividad Examen 7 Resuelto Castilla La Mancha Www.siglo21x.blogspot

Please download to get full document.

View again

All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
  CASTILLA-LA MANCHA / JUNIO 00. LOGSE / BIOLOGIA / EXAMEN COMPLETO Esta prueba consta de tres bloques de preguntas. El primer bloque consta de una pregunta y es OBLIGATORIO (3 puntos). El segundo y tercer bloque constan de dos preguntas cada uno de las cuales se debe elegir una. (3,5 puntos cada uno). BLOQUE 1 1. Describa brevemente (con un máximo de cuatro renglones) los siguientes conceptos: 1. Desoxirribosa. 2. Linfocito T. 3. Estructura primaria. 4. Ácido graso. 5. Nucleósido. 6. Transcripci
Related documents
  CASTILLA-LA MANCHA / JUNIO 00. LOGSE / BIOLOGIA / EXAMEN COMPLETO es un servicio gratuito de Ediciones SM Esta prueba consta de tres bloques de preguntas.El primer bloque consta de una pregunta y es OBLIGATORIO (3 puntos).El segundo y tercer bloque constan de dos preguntas cada uno de las cuales se debeelegir una. (3,5 puntos cada uno).BLOQUE 11.   Describa brevemente (con un máximo de cuatro renglones) los siguientes conceptos:1. Desoxirribosa.6. Transcripción.2. Linfocito T.7. Cloroplasto.3. Estructura primaria.8. Anabolismo.4. Ácido graso.9. Centro activo.5. Nucleósido.10. Retrovirus.BLOQUE 21.   Respecto a la mitosis y a la meiosis:a)   Cita las diferentes fases de la mitosis.b)   ¿Puede la meiosis darse en células haploides? ¿por qué?.c)   ¿Cuáles son las diferencias fundamentales entre ambos procesos?.d)   ¿Hay apareamiento de cromosomas homólogos en la mitosis?. ¿y en la meiosis?.e)   ¿Cuántas células hijas se obtienen en cada uno de estos procesos?. ¿Por qué?.f)   En la mitosis, ¿son idénticos los cromosomas de la célula hija a los de la célulaprogenitora?. ¿Por qué?.g)   ¿Qué es la citocinesis?.2.   Respecto a los lípidos:a)   ¿Son todos los lípidos saponificables?. Defina el proceso de saponificación.b)   ¿Por qué un aceite es líquido y una grasa sólida a temperatura ambiente?.c)   ¿Qué diferencia existe entre un fosfoglicérido y una esfingomielina?.d)   ¿Por qué los ácidos grasos son moléculas anfipáticas?.e)   ¿Qué es un lipoproteína?. Ponga un ejemplo.f)   ¿Qué lípidos desempeñan una función energética en el organismo y cuálesdesempeñan una función estructural?.g)   Nombre las diferentes estructuras lipídicas que aparecen señaladas con una letraen el dibujo.  CASTILLA-LA MANCHA / JUNIO 00. LOGSE / BIOLOGIA / EXAMEN COMPLETO es un servicio gratuito de Ediciones SM BLOQUE 31.   En el dibujo aparece una célula vegetal:a)   Identifique los distintos orgánulos señalados con letras.b)   ¿Qué diferencias básicas hay entre una célula vegetal y una animal?.c)   ¿Qué es la fotosíntesis?. ¿Dónde se produce?.d)   ¿Qué tipo de molécula es la clorofila?. ¿Dónde se encuentra dentro de lacélula?.e)   ¿Qué es un homopolisacárido?f)   Cite un homopolisacárido típico del reino vegetal y comente su composición.g)   ¿Podría un ser humano reponer su energía a partir de la celulosa ingerida enla dieta?. Razone la respuesta.2.   Dada la siguiente secuencia de nucleótidos: AGCUAUAUGCGCACGCAAACCCCAAUUU AG AUA a)   ¿A qué tipo de ácido nucleico pertenecería?. ¿Por qué?.b)   Diga cuáles son los tripletes de iniciación y/o terminación de esta secuencia, sies que presenta alguno.c)   De acuerdo al código genético, ¿podría dar lugar esta secuencia de nucleótidosa un péptido?. En caso afirmativo, ¿cuántos aminoácidos tendría?.d)   Si en esta secuencia introdujéramos entre las bases subrayadas una adenina,¿qué ocurriría con la traducción de esa secuencia. Razone la respuesta.e)   ¿Qué diferencia existe entre un ARN mensajero y uno de transferencia?.f)   ¿Dónde se produce la síntesis de proteínas en una célula?. ¿Mediante quéprocesos?.g)   ¿Cuáles son los constituyentes básicos de las proteínas?. ¿Mediante qué tipode enlace está unidos?  CASTILLA-LA MANCHA / JUNIO 00. LOGSE / BIOLOGIA / EXAMEN COMPLETO es un servicio gratuito de Ediciones SM BLOQUE 11.   Solución:1. Desoxirribosa : Es el más abundante de los desoxiazúcares. Forma parte del ácidodesoxirribonucleico (ADN). La desoxirribosa es una pentosa que deriva de la ribosa pordesoxigenación del carbono-2 de la misma. 2. Linfocito T: Son uno de los tipos de glóbulos blancos de la sangre y se denominan así porque maduran en timo. Son responsables de la respuesta inmune celular    específica alpresentan en su membrana receptores TCR que reconocen los péptidos antigénicos ancladossobre el complejo de histocompatibilidad de las células presentadoras de antígenos. 3. Estructura primaria: Es la secuencia lineal de aminoácidos y nucleótidos que constituyenrespectivamente las proteínas y los ácidos nucleicos. Es la estructura más sencilla y, noobstante, la más importante, ya que determina el resto de las estructuras con nivelessuperiores de organización en ambas biomoléculas. 4.   Ácido graso : Son los lípidos más sencillos y es muy raro encontrarlos en estado libre.Todos ellos poseen una cadena hidrocarbonada larga de tipo alifático y un grupo carboxiloterminal (-COOH). La cadena alifática puede ser saturada. La estructura y propiedades de losdistintos ácidos grasos dependen del número de C y de los enlaces que posean. 5. Nucleósido: Están constituidos por la unión de una pentosa con una base nitrogenada  . Estaunión se lleva a cabo mediante un enlace N- glucosídico que se establece entre el carbono1´de la pentosa y un nitrógeno de la base (el N1 si es pirimidínica y el N9 si es púrica) con lapérdida de una molécula de agua. 6. Transcripción: Es la primera fase de la síntesis proteica o expresión del material genético.El proceso consiste en la síntesis de ARN tomando como molde una de las dos cadenas delADN. El proceso está catalizado por el enzima  ARN-polimerasa o transcriptasa , y se iniciacon la desespiralización parcial de la doble hebra de ADN que se va a transcribir. 7. Solución: Es el plasto de mayor importancia biológica, ya que a través de la fotosíntesis,proceso que tiene lugar en su interior, la energía luminosa se transforma en energía químicaque será utilizada para la transformación de la materia inorgánica en orgánica. 8. Anabolismo: Es la fase del metabolismo de síntesis de moléculas a través de reaccionesendergónicas, es decir, requieren energía para su realización y es posible gracias alcatabolismo. Por lo tanto, se forman moléculas más complejas a partir de otras más sencillas,que las células utilizarán para formar materia propia o de reserva.  CASTILLA-LA MANCHA / JUNIO 00. LOGSE / BIOLOGIA / EXAMEN COMPLETO es un servicio gratuito de Ediciones SM 9. Centro activo: Es la zona específica del enzima que posee estructura tridimensional enforma de hueco, generalmente hidrofóbica, donde tiene lugar la unión enzima-sustratomediante fuerzas intermoleculares de carácter débil. El centro activo del enzima es elresponsable directo de la acción catalítica y específica del enzima. 10. Retrovirus: Estos virus se caracterizan por llevar información genética en una moléculade ARN que debe ser copiado a ADN, durante su ciclo de replicación, merced a la actuaciónde un enzima del propio virus, la transcriptasa inversa . Por tanto, los retrovirus presentan unaforma peculiar de multiplicación contraria al dogma fundamental de la Biología. BLOQUE 2Solución:   a) La mitosis es el proceso de división celular mediante el cual, a partir de una célula madre,aparecen dos células hijas con idéntica dotación cromosómica que su progenitora. Lasdiferentes fases de la mitosis son: 1: Interfase. 2: Profase. 3: Metafase. 4: Anafase. 5: Telofase. b) No, puesto que la meiosis consiste en dos divisiones celulares sucesivas que dan lugar a laformación de cuatro células haploides (n), denominadas gametos, a partir de una única céluladiploide (2n).   c) La mitosis interviene en el crecimiento de los seres pluricelulares y en la reproducciónasexual de los organismos. Es un proceso de división celular mediante el cual, a partir de unacélula madre, aparecen dos células hijas con idéntica dotación cromosómica que suprogenitora.La meiosis tiene lugar en todos los ciclos biológicos en los que se da un proceso dereproducción sexual. Es un tipo de división celular cuyo objetivo es la formación de célulashaploides (n), denominadas gametos (óvulos o espermatozoides), a partir de una céluladiploide (2n). Además, tiene lugar el fenómeno de recombinación génica o intercambio dematerial genético entre las cromátidas de cromosomas homólogos. Por lo tanto, es unmecanismo de división celular que da lugar a un aumento de la variabilidad genética. d) Una de las características de la meiosis es que durante el proceso meiótico tiene lugar unintercambio de material genético entre las cromátidas de los cromosomas homólogos. Laconsecuencia de este intercambio de información hereditaria da lugar al fenómeno de recombinación genética , que es responsable, junto con la mutación, de la variabilidad de lasespecies y es, por lo tanto, el proceso fundamental en el significado biológico de la meiosis.
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!
